PCR amplification of VNTR

Procedure

  1. Prepare a 10 μl PCR reaction system.



    2×Taq mixture: Tiangen company.
  1. Mix and centrifuge for 5 sec in a microcentrifuge.
  1. Install the following program of denaturing-annealing-synthesizing cycle.



    Annealing temperature of MIRU26: 60 °C, of Mtub21: 58 °C

  1. Add 5 μl PCR products in 1 % agarose gel electrophoresis with 100 V, about 70 min.
  2. VNTR Calculations

     

VNTR loci

PCR primer sequence (5’-3’)

Flanking region Size+repeat unit size(bp)

Size of amplicons (bp) and repeat unit size(bp)×no. in H37Rv

Annealing temperature

MIRU26

GCGGATAGGTCTACCGTCGAAATC TCCGGGTCATACAGCATGATCA

243+48

387
48×3

60 °C

Mtub21

AGATCCCAGTTGTCGTCGTC
CAACATCGCCTGGTTCTGTA

92+57

206
57×2

58 °C